Review



goscripttm reverse transcriptase cdna synthesis kit  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Promega goscripttm reverse transcriptase cdna synthesis kit
    Goscripttm Reverse Transcriptase Cdna Synthesis Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/goscripttm+reverse+transcriptase+cdna+synthesis+kit/goscripttm+reverse+transcription+system/pmc12009987-284-17-23
    Average 90 stars, based on 1 article reviews
    goscripttm reverse transcriptase cdna synthesis kit - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6
    Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino ( cita -sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita -sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [ ]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the GoScriptTM Reverse Transcriptase cDNA Synthesis kit (Promega, Madison, WI, USA). β-actin and cita primers (Supplementary Table ) designed with the Open Source Primer3 Software were used to generate PCR amplicons (GoTaq® G2 DNA Polymerase, Promega, Madison, WI, USA). ..

    Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6.
    Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino (cita-sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita-sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [70]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the GoScriptTM Reverse Transcriptase cDNA Synthesis kit (Promega, Madison, WI, USA). β-actin and cita primers (Supplementary Table 4) designed with the Open Source Primer3 Software were used to generate PCR amplicons (GoTaq® G2 DNA Polymerase, Promega, Madison, WI, USA). ..

    Article Title: Ethylene mediated regulation of fiber development in Asiatic cotton (Gossypium arboreum L.)
    Article Snippet: Cotton fiber is single-celled seed trichome, which undergoes considerable changes prior to becoming spinnable.. An array of biological pathways are known to be involved during fiber development with production of phytohormones being one of the major ones.. We investigated the role of ethylene during fibre development in cotton and its correlation with fibre length.

    Article Title: Tankyrase inhibition interferes with junction remodeling, induces leakiness, and disturbs YAP1/TAZ signaling in the endothelium.
    Article Snippet: The following primary antibodies were used for western blots: β-catenin (8480, Cell Signaling), axin1 (3323, Cell Signaling), GAPDH (sc-47724, Santa Cruz), VE-cadherin (2500, Cell Signaling), claudin (35-2500, Invitrogen), AMOTL1 (HPA001196, Sigma-Aldrich), AMOTL2 (23351-1-AP, Proteintech), angiomotin (43130, Cell Signaling), p190RhoGAP (610150, BD Biosciences), IQGAP1 (sc-10792, Santa Cruz), YAP1 (PA1-46189, Thermo Fischer Scientific), TAZ (560235, BD Biosciences), VEGFR2 (2479, Cell Signaling), CD31 (551262, BD Biosciences), tubulin (T6557, Sigma-Aldrich), p-VEGFR2Y1175 (2478, Cell Signaling), p-AktS473 (9271, Cell Signaling), p-ERKS42/S44 (4370, Cell Signaling), p-AKT-substrate (9614, Cell Signaling), CDC42 (2462, Cell Signaling), vinculin (13901, Cell Signaling), HRP-conjugated anti-mouse (A9044, Sigma-Aldrich), and HRP-conjugated anti-rabbit (A9169, Sigma-Aldrich). .. Cells were lysed in RLT Buffer (Qiagen), and total RNA was isolated according to the manufacturer’s recommendations 1 3 (RNeasy Mini Kit, 74104, Qiagen) followed by cDNA synthesis (GoScriptTM Reverse Transcriptase cDNA synthesis kit, Promega). .. Multiplex real-time PCR was performed in triplicates by using master mix (KK4705, Kapa Biosystems) and the TaqMan probes for either ANKDR1 (Hs00998537, Invitrogen), VEGFR2 (Hs00911700, Invitrogen), CTNNB1 (Hs00170025, Invitrogen), CCND1 (Hs00765553, Invitrogen), MYC (Hs00153408, Invitrogen), CTGF (Hs00170014, Invitrogen), and CYR61 (Hs00205294, Invitrogen) while B2M (Hs00187842, Invitrogen) and HPRT (Hs02800695, Invitrogen) were used as internal controls.

    Article Title: Hypoxia induces ROS-resistant memory upon reoxygenation in vivo promoting metastasis in part via MUC1-C.
    Article Snippet: For acute hypoxia exposure, 500,000 cancer cells were seeded overnight in 6 cm plates and cultured under 20% or 1% O2 for 24 h. Total RNAwas extracted from cells using a Direct-zolminiRNA kit (Zymo) with DNase I treatment. .. 1000ng of RNA was used for firststrand DNA synthesis with the GoScriptTM Reverse Transcriptase cDNA Synthesis kit (#A2791, Promega). qPCR was performed using specific human primers and iTaq Universal SYBR Green Fast qPCR mix (#RK21203, Abclonal). ..

    cDNA Synthesis:

    Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6
    Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino ( cita -sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita -sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [ ]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the GoScriptTM Reverse Transcriptase cDNA Synthesis kit (Promega, Madison, WI, USA). β-actin and cita primers (Supplementary Table ) designed with the Open Source Primer3 Software were used to generate PCR amplicons (GoTaq® G2 DNA Polymerase, Promega, Madison, WI, USA). ..

    Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6.
    Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino (cita-sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita-sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [70]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the GoScriptTM Reverse Transcriptase cDNA Synthesis kit (Promega, Madison, WI, USA). β-actin and cita primers (Supplementary Table 4) designed with the Open Source Primer3 Software were used to generate PCR amplicons (GoTaq® G2 DNA Polymerase, Promega, Madison, WI, USA). ..

    Article Title: Ethylene mediated regulation of fiber development in Asiatic cotton (Gossypium arboreum L.)
    Article Snippet: Cotton fiber is single-celled seed trichome, which undergoes considerable changes prior to becoming spinnable.. An array of biological pathways are known to be involved during fiber development with production of phytohormones being one of the major ones.. We investigated the role of ethylene during fibre development in cotton and its correlation with fibre length.

    Article Title: Tankyrase inhibition interferes with junction remodeling, induces leakiness, and disturbs YAP1/TAZ signaling in the endothelium.
    Article Snippet: The following primary antibodies were used for western blots: β-catenin (8480, Cell Signaling), axin1 (3323, Cell Signaling), GAPDH (sc-47724, Santa Cruz), VE-cadherin (2500, Cell Signaling), claudin (35-2500, Invitrogen), AMOTL1 (HPA001196, Sigma-Aldrich), AMOTL2 (23351-1-AP, Proteintech), angiomotin (43130, Cell Signaling), p190RhoGAP (610150, BD Biosciences), IQGAP1 (sc-10792, Santa Cruz), YAP1 (PA1-46189, Thermo Fischer Scientific), TAZ (560235, BD Biosciences), VEGFR2 (2479, Cell Signaling), CD31 (551262, BD Biosciences), tubulin (T6557, Sigma-Aldrich), p-VEGFR2Y1175 (2478, Cell Signaling), p-AktS473 (9271, Cell Signaling), p-ERKS42/S44 (4370, Cell Signaling), p-AKT-substrate (9614, Cell Signaling), CDC42 (2462, Cell Signaling), vinculin (13901, Cell Signaling), HRP-conjugated anti-mouse (A9044, Sigma-Aldrich), and HRP-conjugated anti-rabbit (A9169, Sigma-Aldrich). .. Cells were lysed in RLT Buffer (Qiagen), and total RNA was isolated according to the manufacturer’s recommendations 1 3 (RNeasy Mini Kit, 74104, Qiagen) followed by cDNA synthesis (GoScriptTM Reverse Transcriptase cDNA synthesis kit, Promega). .. Multiplex real-time PCR was performed in triplicates by using master mix (KK4705, Kapa Biosystems) and the TaqMan probes for either ANKDR1 (Hs00998537, Invitrogen), VEGFR2 (Hs00911700, Invitrogen), CTNNB1 (Hs00170025, Invitrogen), CCND1 (Hs00765553, Invitrogen), MYC (Hs00153408, Invitrogen), CTGF (Hs00170014, Invitrogen), and CYR61 (Hs00205294, Invitrogen) while B2M (Hs00187842, Invitrogen) and HPRT (Hs02800695, Invitrogen) were used as internal controls.

    Article Title: Hypoxia induces ROS-resistant memory upon reoxygenation in vivo promoting metastasis in part via MUC1-C.
    Article Snippet: For acute hypoxia exposure, 500,000 cancer cells were seeded overnight in 6 cm plates and cultured under 20% or 1% O2 for 24 h. Total RNAwas extracted from cells using a Direct-zolminiRNA kit (Zymo) with DNase I treatment. .. 1000ng of RNA was used for firststrand DNA synthesis with the GoScriptTM Reverse Transcriptase cDNA Synthesis kit (#A2791, Promega). qPCR was performed using specific human primers and iTaq Universal SYBR Green Fast qPCR mix (#RK21203, Abclonal). ..

    Software:

    Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6
    Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino ( cita -sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita -sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [ ]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the GoScriptTM Reverse Transcriptase cDNA Synthesis kit (Promega, Madison, WI, USA). β-actin and cita primers (Supplementary Table ) designed with the Open Source Primer3 Software were used to generate PCR amplicons (GoTaq® G2 DNA Polymerase, Promega, Madison, WI, USA). ..

    Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6.
    Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino (cita-sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita-sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [70]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the GoScriptTM Reverse Transcriptase cDNA Synthesis kit (Promega, Madison, WI, USA). β-actin and cita primers (Supplementary Table 4) designed with the Open Source Primer3 Software were used to generate PCR amplicons (GoTaq® G2 DNA Polymerase, Promega, Madison, WI, USA). ..

    Polymerase Chain Reaction:

    Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6
    Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino ( cita -sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita -sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [ ]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the GoScriptTM Reverse Transcriptase cDNA Synthesis kit (Promega, Madison, WI, USA). β-actin and cita primers (Supplementary Table ) designed with the Open Source Primer3 Software were used to generate PCR amplicons (GoTaq® G2 DNA Polymerase, Promega, Madison, WI, USA). ..

    Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6.
    Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino (cita-sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita-sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [70]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the GoScriptTM Reverse Transcriptase cDNA Synthesis kit (Promega, Madison, WI, USA). β-actin and cita primers (Supplementary Table 4) designed with the Open Source Primer3 Software were used to generate PCR amplicons (GoTaq® G2 DNA Polymerase, Promega, Madison, WI, USA). ..

    Isolation:

    Article Title: Tankyrase inhibition interferes with junction remodeling, induces leakiness, and disturbs YAP1/TAZ signaling in the endothelium.
    Article Snippet: The following primary antibodies were used for western blots: β-catenin (8480, Cell Signaling), axin1 (3323, Cell Signaling), GAPDH (sc-47724, Santa Cruz), VE-cadherin (2500, Cell Signaling), claudin (35-2500, Invitrogen), AMOTL1 (HPA001196, Sigma-Aldrich), AMOTL2 (23351-1-AP, Proteintech), angiomotin (43130, Cell Signaling), p190RhoGAP (610150, BD Biosciences), IQGAP1 (sc-10792, Santa Cruz), YAP1 (PA1-46189, Thermo Fischer Scientific), TAZ (560235, BD Biosciences), VEGFR2 (2479, Cell Signaling), CD31 (551262, BD Biosciences), tubulin (T6557, Sigma-Aldrich), p-VEGFR2Y1175 (2478, Cell Signaling), p-AktS473 (9271, Cell Signaling), p-ERKS42/S44 (4370, Cell Signaling), p-AKT-substrate (9614, Cell Signaling), CDC42 (2462, Cell Signaling), vinculin (13901, Cell Signaling), HRP-conjugated anti-mouse (A9044, Sigma-Aldrich), and HRP-conjugated anti-rabbit (A9169, Sigma-Aldrich). .. Cells were lysed in RLT Buffer (Qiagen), and total RNA was isolated according to the manufacturer’s recommendations 1 3 (RNeasy Mini Kit, 74104, Qiagen) followed by cDNA synthesis (GoScriptTM Reverse Transcriptase cDNA synthesis kit, Promega). .. Multiplex real-time PCR was performed in triplicates by using master mix (KK4705, Kapa Biosystems) and the TaqMan probes for either ANKDR1 (Hs00998537, Invitrogen), VEGFR2 (Hs00911700, Invitrogen), CTNNB1 (Hs00170025, Invitrogen), CCND1 (Hs00765553, Invitrogen), MYC (Hs00153408, Invitrogen), CTGF (Hs00170014, Invitrogen), and CYR61 (Hs00205294, Invitrogen) while B2M (Hs00187842, Invitrogen) and HPRT (Hs02800695, Invitrogen) were used as internal controls.

    DNA Synthesis:

    Article Title: Hypoxia induces ROS-resistant memory upon reoxygenation in vivo promoting metastasis in part via MUC1-C.
    Article Snippet: For acute hypoxia exposure, 500,000 cancer cells were seeded overnight in 6 cm plates and cultured under 20% or 1% O2 for 24 h. Total RNAwas extracted from cells using a Direct-zolminiRNA kit (Zymo) with DNase I treatment. .. 1000ng of RNA was used for firststrand DNA synthesis with the GoScriptTM Reverse Transcriptase cDNA Synthesis kit (#A2791, Promega). qPCR was performed using specific human primers and iTaq Universal SYBR Green Fast qPCR mix (#RK21203, Abclonal). ..

    Real-time Polymerase Chain Reaction:

    Article Title: Hypoxia induces ROS-resistant memory upon reoxygenation in vivo promoting metastasis in part via MUC1-C.
    Article Snippet: For acute hypoxia exposure, 500,000 cancer cells were seeded overnight in 6 cm plates and cultured under 20% or 1% O2 for 24 h. Total RNAwas extracted from cells using a Direct-zolminiRNA kit (Zymo) with DNase I treatment. .. 1000ng of RNA was used for firststrand DNA synthesis with the GoScriptTM Reverse Transcriptase cDNA Synthesis kit (#A2791, Promega). qPCR was performed using specific human primers and iTaq Universal SYBR Green Fast qPCR mix (#RK21203, Abclonal). ..

    SYBR Green Assay:

    Article Title: Hypoxia induces ROS-resistant memory upon reoxygenation in vivo promoting metastasis in part via MUC1-C.
    Article Snippet: For acute hypoxia exposure, 500,000 cancer cells were seeded overnight in 6 cm plates and cultured under 20% or 1% O2 for 24 h. Total RNAwas extracted from cells using a Direct-zolminiRNA kit (Zymo) with DNase I treatment. .. 1000ng of RNA was used for firststrand DNA synthesis with the GoScriptTM Reverse Transcriptase cDNA Synthesis kit (#A2791, Promega). qPCR was performed using specific human primers and iTaq Universal SYBR Green Fast qPCR mix (#RK21203, Abclonal). ..



    Similar Products

    90
    Promega goscripttm reverse transcriptase cdna synthesis kit
    Goscripttm Reverse Transcriptase Cdna Synthesis Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/goscripttm+reverse+transcriptase+cdna+synthesis+kit/goscripttm+reverse+transcription+system/pmc12009987-284-17-23
    Average 90 stars, based on 1 article reviews
    goscripttm reverse transcriptase cdna synthesis kit - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega goscripttm reverse transcriptase cdna synthesis kit #a2791
    Goscripttm Reverse Transcriptase Cdna Synthesis Kit #A2791, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/goscripttm+reverse+transcriptase+cdna+synthesis+kit/goscripttm+reverse+transcription+system/pmc11438863-411-12-19
    Average 90 stars, based on 1 article reviews
    goscripttm reverse transcriptase cdna synthesis kit #a2791 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega cdna synthesis kit goscripttm reverse transcriptase
    Cdna Synthesis Kit Goscripttm Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/goscripttm+reverse+transcriptase+cdna+synthesis+kit/goscripttm+reverse+transcription+system/pm38194739-108-57-64
    Average 90 stars, based on 1 article reviews
    cdna synthesis kit goscripttm reverse transcriptase - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Promega goscripttm reverse transcriptase cdna synthesis kit with oligo(dt) primer
    Goscripttm Reverse Transcriptase Cdna Synthesis Kit With Oligo(dt) Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/goscripttm+reverse+transcriptase+cdna+synthesis+kit/goscripttm+reverse+transcriptase+cdna+synthesis+kit+with+oligo+dt++primer/pm35398654-64-13-12
    Average 90 stars, based on 1 article reviews
    goscripttm reverse transcriptase cdna synthesis kit with oligo(dt) primer - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results