goscripttm reverse transcriptase cdna synthesis kit (Promega)
90
Structured Review
Promega
goscripttm reverse transcriptase cdna synthesis kit
Goscripttm Reverse Transcriptase Cdna Synthesis Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/goscripttm+reverse+transcriptase+cdna+synthesis+kit/goscripttm+reverse+transcription+system/pmc12009987-284-17-23
Average 90 stars, based on 1 article reviews
Goscripttm Reverse Transcriptase Cdna Synthesis Kit, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/goscripttm+reverse+transcriptase+cdna+synthesis+kit/goscripttm+reverse+transcription+system/pmc12009987-284-17-23
Average 90 stars, based on 1 article reviews
goscripttm reverse transcriptase cdna synthesis kit - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Reverse Transcription:Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6 Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino ( cita -sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita -sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [ ]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6. Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino (cita-sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita-sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [70]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the Article Title: Ethylene mediated regulation of fiber development in Asiatic cotton (Gossypium arboreum L.) Article Snippet: Cotton fiber is single-celled seed trichome, which undergoes considerable changes prior to becoming spinnable.. An array of biological pathways are known to be involved during fiber development with production of phytohormones being one of the major ones.. We investigated the role of ethylene during fibre development in cotton and its correlation with fibre length. Article Title: Tankyrase inhibition interferes with junction remodeling, induces leakiness, and disturbs YAP1/TAZ signaling in the endothelium. Article Snippet: The following primary antibodies were used for western blots: β-catenin (8480, Cell Signaling), axin1 (3323, Cell Signaling), GAPDH (sc-47724, Santa Cruz), VE-cadherin (2500, Cell Signaling), claudin (35-2500, Invitrogen), AMOTL1 (HPA001196, Sigma-Aldrich), AMOTL2 (23351-1-AP, Proteintech), angiomotin (43130, Cell Signaling), p190RhoGAP (610150, BD Biosciences), IQGAP1 (sc-10792, Santa Cruz), YAP1 (PA1-46189, Thermo Fischer Scientific), TAZ (560235, BD Biosciences), VEGFR2 (2479, Cell Signaling), CD31 (551262, BD Biosciences), tubulin (T6557, Sigma-Aldrich), p-VEGFR2Y1175 (2478, Cell Signaling), p-AktS473 (9271, Cell Signaling), p-ERKS42/S44 (4370, Cell Signaling), p-AKT-substrate (9614, Cell Signaling), CDC42 (2462, Cell Signaling), vinculin (13901, Cell Signaling), HRP-conjugated anti-mouse (A9044, Sigma-Aldrich), and HRP-conjugated anti-rabbit (A9169, Sigma-Aldrich). .. Cells were lysed in RLT Buffer (Qiagen), and total RNA was isolated according to the manufacturer’s recommendations 1 3 (RNeasy Mini Kit, 74104, Qiagen) followed by cDNA synthesis ( Article Title: Hypoxia induces ROS-resistant memory upon reoxygenation in vivo promoting metastasis in part via MUC1-C. Article Snippet: For acute hypoxia exposure, 500,000 cancer cells were seeded overnight in 6 cm plates and cultured under 20% or 1% O2 for 24 h. Total RNAwas extracted from cells using a Direct-zolminiRNA kit (Zymo) with DNase I treatment. .. 1000ng of RNA was used for firststrand DNA synthesis with the cDNA Synthesis:Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6 Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino ( cita -sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita -sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [ ]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6. Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino (cita-sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita-sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [70]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the Article Title: Ethylene mediated regulation of fiber development in Asiatic cotton (Gossypium arboreum L.) Article Snippet: Cotton fiber is single-celled seed trichome, which undergoes considerable changes prior to becoming spinnable.. An array of biological pathways are known to be involved during fiber development with production of phytohormones being one of the major ones.. We investigated the role of ethylene during fibre development in cotton and its correlation with fibre length. Article Title: Tankyrase inhibition interferes with junction remodeling, induces leakiness, and disturbs YAP1/TAZ signaling in the endothelium. Article Snippet: The following primary antibodies were used for western blots: β-catenin (8480, Cell Signaling), axin1 (3323, Cell Signaling), GAPDH (sc-47724, Santa Cruz), VE-cadherin (2500, Cell Signaling), claudin (35-2500, Invitrogen), AMOTL1 (HPA001196, Sigma-Aldrich), AMOTL2 (23351-1-AP, Proteintech), angiomotin (43130, Cell Signaling), p190RhoGAP (610150, BD Biosciences), IQGAP1 (sc-10792, Santa Cruz), YAP1 (PA1-46189, Thermo Fischer Scientific), TAZ (560235, BD Biosciences), VEGFR2 (2479, Cell Signaling), CD31 (551262, BD Biosciences), tubulin (T6557, Sigma-Aldrich), p-VEGFR2Y1175 (2478, Cell Signaling), p-AktS473 (9271, Cell Signaling), p-ERKS42/S44 (4370, Cell Signaling), p-AKT-substrate (9614, Cell Signaling), CDC42 (2462, Cell Signaling), vinculin (13901, Cell Signaling), HRP-conjugated anti-mouse (A9044, Sigma-Aldrich), and HRP-conjugated anti-rabbit (A9169, Sigma-Aldrich). .. Cells were lysed in RLT Buffer (Qiagen), and total RNA was isolated according to the manufacturer’s recommendations 1 3 (RNeasy Mini Kit, 74104, Qiagen) followed by cDNA synthesis ( Article Title: Hypoxia induces ROS-resistant memory upon reoxygenation in vivo promoting metastasis in part via MUC1-C. Article Snippet: For acute hypoxia exposure, 500,000 cancer cells were seeded overnight in 6 cm plates and cultured under 20% or 1% O2 for 24 h. Total RNAwas extracted from cells using a Direct-zolminiRNA kit (Zymo) with DNase I treatment. .. 1000ng of RNA was used for firststrand DNA synthesis with the Software:Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6 Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino ( cita -sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita -sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [ ]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6. Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino (cita-sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita-sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [70]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the Polymerase Chain Reaction:Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6 Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino ( cita -sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita -sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [ ]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6. Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino (cita-sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita-sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [70]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the Isolation:Article Title: Tankyrase inhibition interferes with junction remodeling, induces leakiness, and disturbs YAP1/TAZ signaling in the endothelium. Article Snippet: The following primary antibodies were used for western blots: β-catenin (8480, Cell Signaling), axin1 (3323, Cell Signaling), GAPDH (sc-47724, Santa Cruz), VE-cadherin (2500, Cell Signaling), claudin (35-2500, Invitrogen), AMOTL1 (HPA001196, Sigma-Aldrich), AMOTL2 (23351-1-AP, Proteintech), angiomotin (43130, Cell Signaling), p190RhoGAP (610150, BD Biosciences), IQGAP1 (sc-10792, Santa Cruz), YAP1 (PA1-46189, Thermo Fischer Scientific), TAZ (560235, BD Biosciences), VEGFR2 (2479, Cell Signaling), CD31 (551262, BD Biosciences), tubulin (T6557, Sigma-Aldrich), p-VEGFR2Y1175 (2478, Cell Signaling), p-AktS473 (9271, Cell Signaling), p-ERKS42/S44 (4370, Cell Signaling), p-AKT-substrate (9614, Cell Signaling), CDC42 (2462, Cell Signaling), vinculin (13901, Cell Signaling), HRP-conjugated anti-mouse (A9044, Sigma-Aldrich), and HRP-conjugated anti-rabbit (A9169, Sigma-Aldrich). .. Cells were lysed in RLT Buffer (Qiagen), and total RNA was isolated according to the manufacturer’s recommendations 1 3 (RNeasy Mini Kit, 74104, Qiagen) followed by cDNA synthesis ( DNA Synthesis:Article Title: Hypoxia induces ROS-resistant memory upon reoxygenation in vivo promoting metastasis in part via MUC1-C. Article Snippet: For acute hypoxia exposure, 500,000 cancer cells were seeded overnight in 6 cm plates and cultured under 20% or 1% O2 for 24 h. Total RNAwas extracted from cells using a Direct-zolminiRNA kit (Zymo) with DNase I treatment. .. 1000ng of RNA was used for firststrand DNA synthesis with the Real-time Polymerase Chain Reaction:Article Title: Hypoxia induces ROS-resistant memory upon reoxygenation in vivo promoting metastasis in part via MUC1-C. Article Snippet: For acute hypoxia exposure, 500,000 cancer cells were seeded overnight in 6 cm plates and cultured under 20% or 1% O2 for 24 h. Total RNAwas extracted from cells using a Direct-zolminiRNA kit (Zymo) with DNase I treatment. .. 1000ng of RNA was used for firststrand DNA synthesis with the SYBR Green Assay:Article Title: Hypoxia induces ROS-resistant memory upon reoxygenation in vivo promoting metastasis in part via MUC1-C. Article Snippet: For acute hypoxia exposure, 500,000 cancer cells were seeded overnight in 6 cm plates and cultured under 20% or 1% O2 for 24 h. Total RNAwas extracted from cells using a Direct-zolminiRNA kit (Zymo) with DNase I treatment. .. 1000ng of RNA was used for firststrand DNA synthesis with the |